Experimental Physiology
	

Celebrating 100 years
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Experimental Physiology 90.4 pp 613-619
DOI: 10.1113/expphysiol.2004.029462
© The Physiological Society 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/4/613    most recent
expphysiol.2004.029462v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carmeli, E.
Right arrow Articles by Powers, S. K
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carmeli, E.
Right arrow Articles by Powers, S. K
Related Collections
Right arrow Muscle

High intensity exercise increases expression of matrix metalloproteinases in fast skeletal muscle fibres

Eli Carmeli1, Miri Moas2, Shannon Lennon and Scott K Powers

1 Department of Physical Therapy, Tel Aviv University, Ramat Aviv, Tel Aviv 69978, Israel 2 Department of Applied Physiology and Kinesiology, University of Florida, USA


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Metalloproteinases (MMPs) are proteolytic enzymes that function in the extracellular matrix to degrade connective tissues. While it is clear that exercise-induced injury in skeletal muscle promotes increased expression of MMPs, the relationship between exercise intensity and expression of MMPs in muscles is unknown. These experiments tested the hypothesis that exercise-induced expression of matrix metalloproteinases (MMP-2 and MMP-9) is dose-dependent such that high-intensity endurance exercise increases MMP expression whereas low-intensity endurance exercise will not promote MMP expression in skeletal muscles. Female rats (4 months old) completed 2 weeks of treadmill running at either low (18 m min–1; ~50% maximum oxygen consumption rate {eph_152_mu1}) or high intensity (32 m min–1; ~70% {eph_152_mu2}; up to 50 min day–1). Non-running, sedentary animals served as controls. Muscle mRNA and protein levels of MMP-2 and MMP-9 were assessed in gastrocnemius, quadriceps and soleus muscles by reverse transcriptase-polymerase chain reaction and Western blotting, respectively. Results indicate that exercise did not alter MMP-9 in any of these skeletal muscles. Further, our data reveal that low-intensity exercise did not alter the expression of MMP-2 in any of the muscles investigated. In contrast, high-intensity exercise increased both mRNA and protein levels of MMP-2 in skeletal muscles containing a high percentage of fast type II fibres (i.e. gastronemius and superficial quadriceps). These results support the hypothesis that high-intensity exercise is required to promote the expression of MMP-2 in skeletal muscles and that the influence of exercise on MMP-2 expression is dominant in muscles containing a high percentage of fast fibres.

(Received 8 November 2004; accepted after revision 12 April 2005; first published online 15 April 2005)
Corresponding author E. Carmeli: Department of Physical Therapy, Tel Aviv University, Ramat Aviv, Tel Aviv 69978, Israel. Email: elie{at}post.tau.ac.il


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Matrix metalloproteinases (MMPs) play an important role in the homeostasis of the extracellular matrix (ECM) in skeletal muscle (Massova et al. 1998; Carmeli et al. 2004). The ECM surrounding muscle fibres provides structural support and protection, and is important in maintaining functional integrity of the fibres (Birkedal-Hansen et al. 1993). In particular, type IV collagen is a major component in the basement membrane and plays an important role in the cellular arrangement of skeletal muscle fibres. Changing demands in skeletal muscle (e.g. increased or decreased contractile activity) promotes remodelling of the ECM. Although several MMPs exist in muscle, two MMPs that are thought to play an important role in skeletal muscle adaptation to changing contractile demands and to response to injury are MMP-2 (also known as gelatinase A) and MMP-9 (also known as gelatinase B). Both of these MMPs degrade type IV collagen and belong to a group of calcium and zinc endoproteinases that have important functions in homeostasis of the ECM during morphogenesis, proliferation and cell apoptosis in a wide range of tissues (Overall et al. 1991; Strongin et al. 1995; Guerin et al. 1995; Morgunova et al. 1999). Activation of MMP-2 and MMP-9 has also been shown to be involved in various myopathic and inflammatory-induced changes in skeletal muscle (Allen et al. 1999; Choi & Dalakas, 2000; Koskinen et al. 2000; Kieseier et al. 2001). Expression of MMP-2 in skeletal muscle was increased following administration of chronic electrical stimulation (Haas et al. 2000), and expression of MMP-9 was increased after exposure to a chronic increase in blood flow (Van Gieson & Skalak, 2001).

Skeletal muscle fibres possess a high degree of functional and structural plasticity and are capable of responding rapidly to changes in contractile activity. For example, limb immobilization leads to a rapid onset of myofibre atrophy (Reznick et al. 2003) whereas muscle hypertrophy occurs following after overloading (Takala & Virtanen, 2000; Carter et al. 2002). Currently, limited information exists regarding the effects of exercise training on MMPs in skeletal muscle. Therefore, in this study we investigated the effects of prolonged exercise (~50 min) on both mRNA and protein levels of MMP-2 and MMP-9 in rat locomotor skeletal muscles differing in fibre-type composition. Based on the concept that high-intensity exercise in untrained animals results in significant muscle remodelling and perhaps even small levels of muscle injury (Kjaer, 2004), we hypothesized that high-intensity exercise would promote increased expression of both MMP-2 and MMP-9 in skeletal muscles whereas low intensity would result in limited changes in muscle levels of MMP-2 and MMP-9.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals

Pathogen-free female Sprague-Dawley rats (4 months old; body weight, 250–280 g) were maintained under constant conditions of room temperature (22°C) and humidity (40%) with a 12–12 h night–day cycle and fed standard rat chow and water ad libitum. All animals were maintained according the principles of laboratory animal care formulated by Florida University (USA) and Tel Aviv University (Israel) and the experimental procedures received approval from the Ethics Committee for Experimental Procedures of Tel Aviv University.

Experimental procedure

Rats were randomly assigned to one of three groups: (1) low-intensity exercise (n = 8); (2) high-intensity exercise (n = 8); or (3) non-exercising control (n = 6). Animals in the exercise groups were acclimated to treadmill running during a 3-day habituation period at a low intensity of exercise (10 min day–1 at 15 m min–1, 0% gradient, ~40% {eph_152_mu3}). This habituation period was followed by 2 weeks of treadmill running (5 consecutive days per week) according to the following protocols. Low-intensity exercised animals began with 20 continuous minutes of running (18 m min–1, 0% gradient, ~50% {eph_152_mu4}), with daily increases of 10 min until 50 min were achieved. Similarly, high-intensity exercised animals began with 20 min running (32 m min–1, 0% gradient, ~70–75% {eph_152_mu5}) with 10 min added each day until 50 min were achieved. All animals were exercised at the same time each day. The running was done in the active (dark) phase of the day cycle. These exercise intensities were chosen to provide a wide difference in exercise intensities to resolve the impact of exercise intensity on the expression of MMPs in skeletal muscle. Finally, the {eph_152_mu6}values of the animals, and speeds chosen to present each relative workload, were selected based on previous work from our laboratory (Lawler et al. 1993).

Immediately after the last running session, an intraperitoneal injection of sodium pentobarbitol (100 mg kg–1) was administrated to the animals.

After reaching a surgical plane of anaesthesia (stage III, plane 3, resulting in paralysis of muscles and absence of lid, corneal and skin reflex) the right and left of medial gastrocnemius, soleus, rectus femoris (i.e. superficial quadriceps) and vastus intermedius (i.e. deep quadriceps) were quickly removed, weighed and frozen in liquid nitrogen. All tissues were stored at –80°C until required for assay. Note these muscles were selected for study because they represent a broad and differing spectrum of skeletal muscle fibre types. For example, the soleus muscle is composed primarily of highly oxidative type I fibres (type I, 87%; type IIa, 13%; type Iib, 0%). Similarly, both the vastus intermedius (type I, 59%; type Iia, 40%; type Iib, 1%) and medial gastrocnemius (type I, 30; type Iia, 62; type Iib, 0%) are a mixture of highly oxidative fibres. In contrast, the rectus femoris is composed of primarily glycolytic, type IIb fibres (type I, 1%; type Iia, 25%; type Iib, 74%) (Armstrong & Phelps, 1984).

RT-PCR

Total RNA was isolated from 100 mg muscle tissue, taken from the muscle belly, using EZ-RNA isolation kit (Biological Industries, Beit Haemek, Israel). The RNA was used as a template for RT-PCR reaction (Access Quick RT-PCR system, Promega A1702) using MMP-2 primers: sense CCACATTCTGGCCTGAGCTCCC and antisense GATTTGATGCTTCCAAACTTCAC; and {alpha}-tubulin primers (as a reference): sense ATCACAGGCAAGGAAGATGC and antisense ATTGACATCTTTGGGGACCA (Sigma). MMP-9 primers: sense ACCTCAAGTGGCACCATCAT and antisense CCCTCGAAGATGAATGGAAA and {alpha}-tubulin primers as indicated above. The reaction products were run on 1.2% agarose gel.

Control blots were performed using only secondary antibody.

SDS-PAGE and Western blot analysis

Muscle tissue (100 mg) was homogenized (3 times 20 s homogenization and 10 s pause) in cold buffer containing (mM): Trizma base 42, KCl 300, MgCl 2.5, and 0.1% Triton X-100 and protease inhibitor cocktail (P-8340, Sigma), and centrifuged (10 000 g for 10 min at 4°C). The supernatants were collected, and total protein concentration was measured using Bradford reagent (Bio-Rad, Hercules, CA, USA). Equal amounts of supernatants were suspended in protein sample buffer containing 5% ß-mercaptoethanol, vortexed, boiled and centrifuged. The supernatants were treated with 10% SDS-PAGE. Proteins from polyacrylamide gels were transferred onto nitrocellulose membranes. Blots were blocked with 2.5% skimmed milk (Bio-Rad) in PBST (PBS containing 0.05% Tween 20) for 1 h, reacted with MMP-2-specific goat polyclonal antibody (Santa Cruz Biotechnology, CA, USA) and {alpha}-tubulin-specific mouse monoclonal immunoglubulin (Ig)G2a antibody (Santa Cruz Biotechnology) for 1 h, washed three times with 2.5% skimmed milk in PBST for 30 min (3 x 10 min), reacted with bovine anti-goat IgG-HRP (Santa Cruz Biotechnology) or donkey anti-mouse IgG-HRP (Santa Cruz Biotechnology), respectively, for 30 min, and washed once with 2.5% skimmed milk in PBST for 10 min and three times with PBST for 9 min (3 x 3 min). The membranes were developed using Super Signal West Pico chemiluminescent substrate (Pierce Chemical Co, Santiago, Chile) followed by exposure to X-ray films (Fuji). Quantification of MMP-2 and MMP-9 was performed using the Scion Image Version 4.0.2 beta (Scion Cooperation).

Statistical analysis

A one-way analysis of variance was used to determine whether group differences existed in skeletal muscle MMP-2 and MMP-9 levels. Where appropriate, specific group differences were determined using t tests employing a Bonferroni correction for multiple tests. Significance was established at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The effects of running on body and muscle weights are reported in Table 1. Although no differences existed in animal body weights between the experimental groups at the beginning of the experiments, 2 weeks of high intensity exercise resulted in a significant decrease in body weight. Nonetheless, no significant differences existed in muscle weights between any of the experimental groups. Finally, records of both water and caloric intake of the animals during the experimental period revealed no group differences suggesting that body weight differences were not due to dehydration or malnutrition.


View this table:
[in this window]
[in a new window]
 
Table 1. Body and muscle weights following 2 weeks of treadmill running
 
To address the question of whether exercise training results in significant changes in muscle levels of MMP-2 and MMP-9, we measured muscle levels of both mRNA and protein for these important metalloproteinases. In comparison to the contralateral leg, the MMP-2 mRNA levels significantly increased in both the gastronemius and superficial quadriceps muscles following exercise training and the magnitude of the mRNA increase was greatest in animals exercised at the high speed (Figs 1A and 2). Consistent with the mRNA results, MMP-2 protein levels were also significantly elevated in the gastronemius and superficial quadriceps muscles following both fast and slow running (Figs 1B and 3). In contrast, mRNA levels of MMP-2 and MMP-9 were undetectable in both the soleus and deep quadriceps muscles following 2 weeks of slow or fast running (Fig. 4). Finally, exercise did not alter muscle protein levels of MMP-2 or MMP-9 (data on MMP-9 are not presented) in these muscles (Fig. 3).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1.  RT-PCR and Western Blot for gastrocnemius (Gast) and superficial quadriceps (SQuad)
A, RT-PCR. Left lane, marker; lane 1, gastrocnemius following fast-speed running; lane 2, gastrocnemius following slow-speed running; lane 3, gastrocnemius control; lane 4, superficial quadriceps control; lane 5, superficial quadriceps following slow-speed running; lane 6, superficial quadriceps following fast-speed running. B, Western Blot. All lanes as in A.

 


View larger version (9K):
[in this window]
[in a new window]
 
Figure 2.  Skeletal muscle MMP-2 mRNA (ng/ml) in trained animals
*Significantly different at P < 0.05

 


View larger version (44K):
[in this window]
[in a new window]
 
Figure 3.  RT-PCR and Western blot for soleus (Sol) and deep quadriceps (DQuad)
A, RT-PCR. Left lane, marker; lane 1, soleus following fast-speed running; lane 2, soleus following slow-speed running; lane 3, soleus control; lane 4, deep quadriceps control; lane 5, deep quadriceps following slow-speed running; lane 6, deep quadriceps following fast-speed running. B, Western blot. All lanes as in A.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 4.  Content of MMP-2 protein (µg) relative to muscle weight (mg) for the four different muscles following fast- and slow-speed running
*Significantly different at P < 0.05

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Overview of major findings

To our knowledge, these are the first experiments to investigate the impact of exercise intensity on the expression of metalloproteinases in skeletal muscles differing in fibre types. Specifically, these experiments were designed to test the hypothesis that exercise-induced expression of the matrix metalloproteinases MMP-2 and MMP-9 is dose-dependent such that high-intensity endurance exercise increases MMP expression whereas low-intensity endurance exercise will not promote MMP expression in skeletal muscles. Our results only partially support this postulate. Indeed, data analysis revealed that high-intensity exercise-induced increases in MMPs are limited to an increased expression of MMP-2 in skeletal muscles containing a high percentage of fast fibres. In contrast, both low- and high-intensity exercise did not increase the expression of either MMP-2 or MMP-9 in skeletal muscle fibres primarily composed of highly oxidative (i.e. types I and IIa) fibres.

Exercise-induced MMP expression in skeletal muscles

Differences exist in the composition of the ECM surrounding myofibres of differing functional types. For example, slow-twitch muscles of rats contain more collagen in the ECM than fast-twitch muscles (Zimmerman et al. 1993; Ahtikoski et al. 2003). Hence, it is conceivable that the adaptation responses of muscles with predominantly slow-twitch fibres will differ from those of fast-twitch fibres and this may be reflected in changes in expression of MMPs.

In normal skeletal muscle, MMP-2 levels are relatively low in the ECM and early expression of MMP-2, a few days before the increase of endothelial growth factors due to muscle overload, is regulated by cytokines and growth factors such as capillary growth factor (Rivilis et al. 2002). By comparison, MMP-9 is typically absent in the ECM of skeletal muscle, yet MMP-9 expression in the brain is elevated in response to acute inflammatory conditions such as ischaemia–reperfusion injury (Fujimura et al. 1999).

Although the expression of proteolytic enzymes is known to be associated with various myopathies and inflammatory conditions (Kieseier et al. 1999), their involvement in skeletal muscle remodelling in response to varying conditions of loading has received limited investigative attention. Excessive muscular activity, such as in high-intensity sporting activities, may lead to structural damage involving protein degradation, myopathy and muscle dysfunction (Gordon 1995). The results of the present study clearly demonstrate that treadmill running at fast speeds leads to the expression of the inactive precursor, or zymogen (pro MMP-2, 72 kDa), indicating accelerated activities of the active form of MMP-2 and increased capacity for ECM degradation. In contrast, neither low- nor high-intensity exercise as associated with an up-regulation of MMP-9 in any skeletal muscle investigated.

Our finding that high intensity exercise promoted an increased expression of MMP-2 in muscles with predominantly fast fibres differs from work by Koskinen et al. (2000) who reported that MMP-2 mRNA increased in both slow and fast skeletal muscles following down-hill running. A definitive explanation for these divergent findings is not available. Nonetheless, it seems likely that differences in the exercise protocol between the current study and the work of Koskinen et al. (2000) is likely to play a role in the differing results. Indeed, Koskinen et al. (2000) employed a 1-day exercise protocol of downhill running which produced an eccentric contraction that resulted in significant levels of acute skeletal muscle injury, whereas the protocol used in the current study was chronic (i.e. 2 weeks) treadmill running that was unlikely to promote continued levels of muscle injury. Moreover, another important difference in the current study and the work of Koskinen et al. (2000) is the fact that down-hill running involves muscle action by primarily extensor muscles. Therefore, the muscle recruitment pattern during down-hill running differs markedly from the exercise-training protocol used in the current study.

An important finding in this study is that we were unable to detect MMP-9 at the mRNA or protein level in muscles after treadmill running at fast or slow speeds. These results agree with the viewpoint that only under extreme or abnormal conditions of muscle activation (i.e. inflammation or chronic denervation) is MMP-9 expressed.

In regard to MMP-2 and MMP-9 activity, we recently reported that both MMP-2 and MMP-9 might be inhibited by tissue inhibitors of metalloproteinases 1 and 2 (TIMP-1 and TIMP-2), which, similar to MMP-2 and MMP-9, are secreted by the myofibres. The catalytic activity of MMP-2 and 9 is regulated directly by the level by TIMP-1 and 2. The TIMPs derived from myofibres are secreted into the ECM and bind to the zymogen form of MMP-2 and MMP-9; this binding regulates the formation and levels of mature MMP-2 and MMP-9 (Guerin & Holland 1995). Importantly, we recently confirmed that activity levels of TIMPs changed in parallel with activity changes demonstrated for MMP-2 and MMP-9 (Overall et al. 1991; Singh et al. 2000).

In the current study, we demonstrated that different muscle fibre types show differing response patterns to running. We found that type II muscle fibres were more susceptible to exercise overuse than type I muscle fibres. From previous reports, it has been shown that overuse leads to muscle tissue damage followed by functional decline (Armstrong et al. 1983). The significant changes in type II fibres were observed only following 2 weeks of high intensity exercise. Both in rectus femoris and medial gastrocnemius muscles, net tissue degradation was observed when related to soluble protein concentration, suggesting a higher rate of protein degradation in (type II) fast-twitch muscle fibres than in (type I) slow-twitch muscle fibres. Therefore, our findings suggest that fast fibres are more responsive to exercise-induced changes in MMP expression; nonetheless, immunohistochemical analyses are required to definitively identify which muscle fibre types are affected by exercise.

Conclusions

We conclude that high-intensity exercise is required to promote the expression of MMP-2 in skeletal muscles and that the influence of exercise on MMP-2 expression is dominant in muscles containing a high percentage of fast fibres. Moreover, our results indicate that the exercise, in the absence of muscle injury, does not promote the expression of MMP-9 in slow or fast skeletal muscles. Collectively, our results suggest that high intensity exercise training may affect the overall balance of protein turnover in skeletal muscle fibres, and that changes involving degradation and synthesis of ECM, are more distinct in type II muscle fibres than in type I fibres. These findings form the foundation for additional research to determine the functional significance of changes in the expression of MMPs in skeletal muscles in response to exercise training.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Ahtikoski AM, Koskinen SOA, Virtanen P, Kovanen V, Risteli J & Takala TES (2003). Synthesis and degradation of type IV collagen in rat skeletal muscle during immobilization in shortened and lengthened positions. Acta Physiol Scand 177, 473–481.[CrossRef][Medline]

Allen DL, Roy RR & Edgerton VR (1999). Myonuclear domains in muscle adaptation and disease. Muscle Nerve 22, 1350–1360.[CrossRef][Medline]

Armstrong RB, Ogilvie RW & Schwane JA (1983). Eccentric exercise-induced injury to rat skeletal muscle. J Appl Physiol 54, 80–93.[Abstract/Free Full Text]

Armstrong RB & Phelps RO (1984). Muscle fiber type composition of the rat hindlimb. Am J Anat 171, 259–272.[CrossRef][Medline]

Birkedal-Hansen H (1993). Proteolytic remodeling of extracellular matrix. Curr Opin Cell Biol 7, 728–735.

Carmeli E, Moas M, Reznick AZ & Coleman R (2004). Matrix metalloproteinases and skeletal muscle: a brief review. Muscle Nerve 29, 191–197.[CrossRef][Medline]

Carter GT, Abresch RT & Fowler WM Jr (2002). Adaptations to exercise training and contraction-induced muscle injury in animal models of muscular dystrophy. Am J Phys Med Rehabil 81, S151–S161.[Medline]

Choi YC & Dalakas MC (2000). Expression of matrix metalloproteinases in the muscle of patients with inflammatory myopathies. Neurology 54, 65–71.[Abstract/Free Full Text]

Fujimura M, Gasche Y, Morita-Fujimura Y, Massengale J, Kawase M & Chan PH (1999). Early appearance of activated MMP-9 and blood–brain barrier disruption in mice after focal cerebral ischemia and reperfusion. Brain Res 842, 92–100.[CrossRef][Medline]

Gordon T (1995). Fatigue in adapted systems. Overuse and underuse paradigms. Adv Exp Med Biol 384, 429–456.[Medline]

Guerin CW & Holland PC (1995). Synthesis and secretion of matrix degrading metalloproteinases by human skeletal satellite cells. Dev Dyn 202, 91–99.[Medline]

Haas TL, Milkiewicz M, Davis SJ, Zhou AL, Egginton S, Brown MD, Madri JA & Hudlicka O (2000). Matrix metalloproteinase activity is required for activity-induced angiogenesis in rat skeletal muscle. Am J Physiol Heart Circ Physiol 279, H1540–H1547.[Abstract/Free Full Text]

Kieseier BC, Schneider C, Clements JM, Gearing AJH, Gold R, Toyka KV & Hartung HP (2001). Expression of specific matrix metalloproteinases in inflammatory myopathies. Brain 124, 341–351.[Abstract/Free Full Text]

Kieseier BC, Seifert T, Giovannoni G & Hartung HP (1999). Matrix metalloproteinases in inflammatory demyelination: targets for treatment. Neurology 53, 20–25.[Abstract/Free Full Text]

Kjaer M (2004). Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiol Rev 84, 649–698.[Abstract/Free Full Text]

Koskinen SAO, Kjaer M, Mohr T, Sorensen FB, Suuronen T & Takala TES (2000). Type IV collagen and its degradation in paralyzed human muscle: effect of functional electrical stimulation. Muscle Nerve 23, 580–589.[CrossRef][Medline]

Koskinen SOA, Wang W, Ahtikoski AM, Kjaer M, Han XY, Komulainen J, Kovanen V & Takala TES (2001). Acute exercise induced changes in rat skeletal muscle mRNAs and proteins regulating type IV collagen content. Am J Physiol Regul Integr Comp Physiol 280, R1292–R1300.[Abstract/Free Full Text]

Lawler J, S.Powers J, Hammeren & Martin AD (1993). Oxygen cost of treadmill running 24 month old Fischer-344 rats. Med Sci Sports Exerc 25, 1259–1264.

Massova I, Kotra LP, Fridman R & Mobashery S (1998). Matrix metalloproteinases: structures, evolution, and diversification. FASEB J 12, 1075–1095.[Abstract/Free Full Text]

Morgunova E, Tuuttila A, Bergmann U, Isupov M, Lindqvist Y, Schneider G & Tryggvason K (1999). Structure of human pro-matrix metalloproteinase-2: activation mechanism revealed. Science 284, 1667–1670.[Abstract/Free Full Text]

Overall CM, Wrana JL & Sodek J (1991). Transcriptional and post-transcriptional regulation of 72-kDa gelatinase/type IV collagenase by transforming growth factor beta 1 in human fibroblasts. Comparisons with collagenase and tissue inhibitor of matrix metalloproteinase gene expression. J Biol Chem 266, 14064–14071.[Abstract/Free Full Text]

Reznick AZ, Menashe O, Bar-Shai M, Coleman R & Carmeli E (2003). Expression of matrix metalloproteinases, inhibitor, and acid phosphatase in muscles of immobilized hindlimbs of rats. Muscle Nerve 27, 51–59.[CrossRef][Medline]

Rivilis I, Milkiewicz M, Boyd P, Goldstein J, Brown MD, Egginton S, Hansen FM, Hudlicka O & Haas TL (2002). Differential involvement of MMP-2 and VEGF during muscle stretch – versus shear stress-induced angiogenesis. Am J Physiol Heart Circ Physiol 283, H1430–H1438.[Abstract/Free Full Text]

Singh A, Nelson-Moon ZL, Thomas GJ, Hunt NP & Lewis MP (2000). Identification of matrix metalloproteinases and their tissue inhibitors type 1 and 2 in human masseter muscle. Arch Oral Biol 45, 431–440.[CrossRef][Medline]

Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA & Goldberg GI (1995). Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270, 5331–5338.[Abstract/Free Full Text]

Takala TE & Virtanen P (2000). Biochemical composition of muscle extracellular matrix: the effect of loading. Scand J Med Sci Sports 10, 321–325.[CrossRef][Medline]

Van Gieson EJ & Skalak TC (2001). Chronic vasodilation induces matrix metalloproteinase 9 (MMP-9) expression during microvascular remodeling in rat skeletal muscle. Microcirculation 8, 25–31.[CrossRef][Medline]

Zimmerman SD, McCormick RJ, Vadlamudi RK & Thomas DP (1993). Age and training alter collagen characteristics in fast-and slow-twitch rat limb muscle. J Appl Physiol 75, 1670–1674.[Abstract/Free Full Text]


    Acknowledgements
 
We would like to thank Anne and Eli Shapira Charitable Foundation, from Portland Oregon, for supporting this work.




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Hellsten, N. Rufener, J. J. Nielsen, B. Hoier, P. Krustrup, and J. Bangsbo
Passive leg movement enhances interstitial VEGF protein, endothelial cell proliferation, and eNOS mRNA content in human skeletal muscle
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R975 - R982.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. A. Dennis, B. Przybyla, C. Gurley, P. M. Kortebein, P. Simpson, D. H. Sullivan, and C. A. Peterson
Aging alters gene expression of growth and remodeling factors in human skeletal muscle both at rest and in response to acute resistance exercise
Physiol Genomics, February 19, 2008; 32(3): 393 - 400.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
F. Suhr, K. Brixius, M. de Marees, B. Bolck, H. Kleinoder, S. Achtzehn, W. Bloch, and J. Mester
Effects of short-term vibration and hypoxia during high-intensity cycling exercise on circulating levels of angiogenic regulators in humans
J Appl Physiol, August 1, 2007; 103(2): 474 - 483.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
K. M. Heinemeier, J. L. Olesen, F. Haddad, H. Langberg, M. Kjaer, K. M. Baldwin, and P. Schjerling
Expression of collagen and related growth factors in rat tendon and skeletal muscle in response to specific contraction types
J. Physiol., August 1, 2007; 582(3): 1303 - 1316.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
90/4/613    most recent
expphysiol.2004.029462v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carmeli, E.
Right arrow Articles by Powers, S. K
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carmeli, E.
Right arrow Articles by Powers, S. K
Related Collections
Right arrow Muscle


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS